Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferatorâÃ?Â?Ã?Â?activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA MethylationâÃ?Â?Ã?Â?Direct™ Kit; Zymo Research). RealâÃ?Â?Ã?Â?time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARγ coactivator (PPARG) M3 were 5’âÃ?Â?Ã?Â?aagacggtttggtcgatcâÃ?Â?Ã?Â?3’ (forward), and5’âÃ?Â?Ã?Â?cgaaaaaaaatccgaaatttaaâÃ?Â?Ã?Â?3’ (reverse) and those for PPARG unmethylated were: 5’âÃ?Â?Ã?Â?gggaagatggtttggttgattâÃ?Â?Ã?Â?3’ (forward) and 5’âÃ?Â?Ã?Â?ttccaaaaaaaaatccaaaatttaaâÃ?Â?Ã?Â?3’ (reverse). Intergroup differences were calculated using the Mann–Whitney UâÃ?Â?Ã?Â?test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesityâÃ?Â?Ã?Â?induced methylation in pregnancy.
Select your language of interest to view the total content in your interested language
Annals of Medical and Health Sciences Research received 20588 citations as per google scholar report